7/18/06: A journal article describing ZF Tools was published in Nucleic Acids Research.

3/10/06: New parse utility added. This feature permits long target sites identified by the Search Tool to be parsed into smaller sites for easier investigation. Also, triplets predicted to have target site overlap issues are highlighted. Another improvement is that the multi-target specificity assays for each triplet have been broken down into individual image files for much easier viewing. These images are linked to triplet names in the Design, Search (and Parse), and Deconvolute tools. The graphs are now directly viewable from the Search (and Parse) tool for each triplet, in order to help design ZFPs with high specificity.

2/7/06: Target site overlap (TSO) flag updated to permit T residues to follow a GNG triplet without flagging. This update reduces the number of sites flagged as potentially problematic compared with the previous version.

2/2/06: ZF Tools gets new functionality with the release of Version 2.0. The Search Tool is revamped to permit searching for both contiguous and separated target sites. This functionality is especially important for designing zinc finger nucleases. The Design Tool is also improved to permit greater flexibility in altering the backbone and linker sequences (for advanced users only). Note that if you don't change the default sequences, the output is unchanged from the previous version. Many other cosmetic changes made throughout as well.

12/23/05: ZF Tools website is featured in a Science article about zinc finger proteins.

9/15/05: The Barbas lab announces the release of the ZF Tools website for finding zinc finger protein target sites and designing zinc finger proteins. Please explore the site and feel free to give us feedback using the "Send feedback" link on the left-hand navigation bar.

Intro to ZFPs A great deal of progress in the development of modular protein domains that recognize specific triplets of DNA sequence has been made. These domains can be fused together to create proteins that can bind to a chosen DNA sequence. Such proteins can be combined with effector domains that result in transcriptional activators or repressors, thus enabling researchers to have transcriptional control of virtually any gene.

The Cys2-His2 zinc finger motif, identified first in the DNA and RNA binding transcription factor TFIIIA, is perhaps the ideal structural scaffold on which a sequence specific protein might be constructed. A single zinc finger domain consists of approximately 30 amino acids with a simple ββα fold stabilized by hydrophobic interactions and the chelation of a single zinc ion. Presentation of the α-helix of this domain into the major groove of DNA allows for sequence specific base contacts. Each zinc finger domain typically recognizes three base pairs of DNA, though variation in helical presentation can allow for recognition of a more extended site. In contrast to most transcription factors that rely on dimerization of protein domains for extending protein-DNA contacts to longer DNA sequences or addresses, simple covalent tandem repeats of the zinc finger domain allow for the recognition of longer asymmetric sequences of DNA by this motif. Since each zinc finger domain typically binds three base pairs of sequence, a complete recognition alphabet requires the characterization of 64 domains. We have taken a systematic approach towards the generation of a modular recognition alphabet. We have used selection by phage display and refinement by site directed mutagenesis to prepare the zinc finger domains representing the 5′-GNN-3′, 5′-ANN-3′ and 5′-CNN-3′ subsets of this 64-member recognition code. Furthermore, several 5′-TNN-3′ domains are have been published by our group (see citations below). We are also actively engaged in selecting the remaining portion of the 5′-TNN-3′ recognition alphabet (unpublished data).

Tools overview This site provides several tools for selecting zinc finger protein (ZFP) target sites and for designing the proteins that will target them. These ZFPs can be fused with effector domains that confer transcriptional activation or repression activity as well as catalytic functions.

The first tool, "Search DNA Sequence for Contiguous or Separated Target Sites" permits users to scan a given DNA sequence for consecutive DNA triplets that we can target with the zinc finger domains we have published. The user may also specify that the target sites be separated by a non-targeted spacer, and that the target sites are on opposite strands as is done for nuclease design (click here for a further explanation). And please see DNA search tips for more information about searching DNA sequences.

The second ZF Tool, "Design a Zinc Finger Protein," takes as input a valid zinc finger target site (in other words, a DNA sequence comprised of triplets for which we have created novel zinc finger domains). The target sequence may be input from either the home page, or as a link from the output of the "Search Sequence for Target Sites" page.

The third tool, "Predict Zinc Finger Protein Binding Site," permits users to deconvolute the amino acid sequence of a zinc finger into its constituent binding helices. This feature is most useful for reverse-engineering ZFPs selected from a library approach to determine the targeted DNA sequences. The input must be the amino acid sequence of the ZFP, as opposed to the DNA sequence obtained from a DNA sequencing run. The algorithm searches for helices developed by our laboratory and does not recognize any backbone sequence. Therefore, errors in the backbone sequence will not hinder identification of helices. A direct link to the NCBI BLAST page is provided for predicted target sequences to see where they might match in different genomes.

Another ZF tool is to "Search DNA Sequence and Target Site for Close Match." This tool is most often used in one of two ways. First, the predicted DNA target site from the "Predict ZF Binding Site" tool does not always have a 100% match against a DNA region probed with a library. This can occur if the ZFP has a slight promiscuity. In these cases, it can be useful to search the predcited site against the region used for a library selection allowing mismatches or wild cards in the search. Second, this feature can be used to find ZF nuclease sites. It should only be used to search for nuclease sites in the event that more flexibility in the seach than provided by the first tool, "Search DNA Sequence for Contiguous or Separated Target Sites", is desired since this tool is less user-friendly for this task.

DNA search tips You may search a sequence of up to 10 kb for potential ZFP binding sites. ZFP proteins can activate or repress transcription from several hundred nucleotides from the transcriptional start site. This means that if you are searching a gene for good regions to regulate, you might consider -600 to +200 relative to the start of transcription, for instance. The sequence you enter should consist only of the DNA bases (A, C, G and T). If your input is in another format (for example line numbers are included), a warning message is given and the input is stripped of illegal characters (including carriage returns).

Usually ZF Tools will find many potential target sites within a given region. Sites 18 bp or longer are usually unique within the human genome, and uniqueness can be confirmed by performing a BLAST search. A link is provided from the protein design page to the NCBI BLAST page for potential target sequences.

ZFP design tips The main parameters to optimize when designing a ZFP are the specificity and affinity. We believe that a 6-finger protein intended to recognize an 18 bp target site and constructed using the canonical TGEKP linker is the most optimal solution for endogenous gene regulation. Proteins that bind their target with an affinity of 10 nM or better are productive regulators (Segal et al.) and in our hands, ZFPs with an affinity of 1 nM or better have the best activity. You can determine the affinity for a ZFP by performing an Electrophoretic Mobility Shift Assay (EMSA). Sometimes even target sites that are close together can yield different repression/activation efficiences. Efficiencies of ZFP action can vary due to many factors including the accessibility of the DNA (whether it is in a heterochromatic state or not), whether other proteins are bound that occlude ZFP accessibility, and the affinity of the ZFP. ZF Tools may find many potential target sites, and choosing which ones to pursue is not always simple. It may be helpful to first perform a DNA nuclease sensitivity experiment for your chosen gene to get a feel for regions that are expected to be accessible for ZFP binding.

Available triplets
The domain triplets available for protein design and sequence searching are:

GAA	GCA	GGA	GTA	GAC	GCC
GGC	GTC	GAG	GCG	GGG	GTG
GAT	GCT	GGT	GTT	AAA	AAC
AAG	AAT	ACA	ACC	ACG	ACT
AGA	AGC	AGG	AGT	ATA	ATG
ATT	TGA	TGG	TAG	CAA	CAG
CAT	CCA	CCC	CCG	CCT	CGA
CGC	CGG	CGT	CTA	CTG	CAC
CTT

Synthesize a ZFP Production of zinc finger proteins can be best achieved using either of two methods. The first is to sequentially assemble the fingers using standard cloning techniques. We estimate that for a 6-finger protein recognizing an 18 bp target site, the cloning can be performed in about two weeks or less by a skilled molecular biologist, especially if the two 3-finger subsites are cloned in parallel and assembled in the final step.

Alternatively, a very efficient method for obtaining the final DNA sequence is to have it commercially synthesized. There are now several companies that can synthesize long DNA sequences for a reasonable cost (competitive with cost of labor and supplies required for in-house cloning). These sequences can be provided in a vector for rapid subcloning into your expression vector of choice and for amplification. Companies performing this service include Bio Basic, GeneArt, Blue Heron Biotechnology, and Retrogen none of which do we have affiliations with or endorse. We have had the DNA for 6-finger proteins synthesized, sequenced, and delivered in under two weeks from the time of ordering. When you order the sequence, you can specify mutations in the amino acid sequence that result in convenient restriction sites. For instance, we often mutate codons at the sequence ends to have a 5' XhoI site and a 3' SpeI site (without causing amino acid mutations). See the effector domains section for more detailed information on cloning.

Effector domains Numerous effector domains have been shown to confer transcriptional control to ZFPs.

Activation domains include: VP64, a derivative of the herpes simplex virus protein VP16; and the activation domain of the human p65 protein, a component of the NF-kB complex.

Repression domains include: the human-derived Krüppel-associated box (KRAB or SKD); the Mad mSIN3 interaction domain (SID); the ERF repressor domain (ERD); and a direct fusion with histone deacetylase HDAC1.

In our hands the KRAB (SKD) repression and VP64 activation domains often yield good results. Representative diagrams depicting how the effector domains are fused with ZFPs, a nuclear localization sequence (NLS) and an HA-tag are shown below. Expression could be driven by the CMV promoter, for example. Note that the we fuse the KRAB repressor N-terminal to the ZFP and the VP64 activation domain C-terminal to the ZFP. The DNA sequence of the HLTR3 6-ZFP protein fused to the KRAB domain with an NLS and HA-tag is available here.

The DNA sequences in the above diagrams include (please re-confirm before using):
NLS (nuclear localization sequence)
CCGAAAAAGAAACGCAAAGTT

Sfi I site 1
GGCCCAGGCGGCC

Sfi I site 2
GGCCAGGCCGGCC

HA tag (for Western blotting)
TACCCGTACGACGTTCCGGACTACGCTTCT

KRAB (SKD) domain (with linker sequence)
GATGCTAAGTCACTGACTGCCTGGTCCCGGACACTGGTGACCTTCAAGGATGTGTTTGTGGACTTCACCAGGGAGGAGTGGAAGCTGCTGGA
CACTGCTCAGCAGATCCTGTACAGAAATGTGATGCTGGAGAACTATAAGAACCTGGTTTCCTTGGGTTATCAGCTTACTAAGCCAGATGTGA
TCCTCCGGTTGGAGAAGGGAGAAGAGCCCTGGCTGGTGGAGAGAGAAATTCACCAAGAGACCCATCCTGATTCAGAGACTGCATTTGAAATC
AAATCATCAGTT

VP64 domain
GGGCGCGCCGACGCGCTGGACGATTTCGATCTCGACATGCTGGGTTCTGATGCCCTCGATGACTTTGACCTGGATATGTTGGGAAGCGACGC
ATTGGATGACTTTGATCTGGACATGCTCGGCTCCGATGCTCTGGACGATTTCGATCTCGATATGTTAATTAAC

Separated ZFP binding sites (nuclease design). Zinc fingers fused to catalytic domains can direct a desired catalytic activity to a chosen genomic target. For instance, zinc fingers fused to a nuclease catalytic domain (such as Fok I) can direct site-specific cleavage at a chosen genomic target. The Fok I catalytic domains (fused with the C-terminus of a ZFP) do not cleave the DNA unless they are bound to it by the ZFPs and dimerize. Typically, two 4-finger zinc finger fusion proteins are directed at DNA sequences separated by a 6 bp spacer. The ZFPs can be situated on the DNA strands so that either their N- or C-termini are closer. The choice between termini alignment will be determined by whether the catalytic domain-ZFP fusion works better on the N or C terminus of the ZFP. The Fok I nuclease is typically fused to the C-terminus. See the diagram below for an illustration of both arrangements.

ZF Tools has two methods for finding separated ZFP target sites. The first, and by far the easiest, is to use the "Search DNA Sequence for Contiguous or Separated Target Sites" tool. Remember to select the "Separated targets" button to enable the separated target site search. One advantage of the first method is that ZF Tools only reports target sites for which we have corresponding ZFP helices. For example, there are only 15 out of a possible 16 ANN triplets that can be targeted with our helices. For an explanation of the various parameters associated with search, click here. On the other hand, the second method (the "Search Sequence and Target Site for Close Match" tool) does not take into account whether a helix exists for a given triplet. Nonetheless, should you have access to helices other than those published by our lab, this method can enable you to find potential separated target sites.

To use the second method to search for separated target sequences, you can use IUPAC codes to describe sequences. For example, NNYNNYNNYNNYNNNNNNRNNRNNRNNRNN will find a 30 bp sequence with binding sites for two tetrameric domains (composed of ANN or GNN zinc fingers) flanking a random 6 bp core (see figure below). The inverted orientation enables the functional dimerization of the nuclease catalytic domains fused to the C-termini of each ZFP. Note that the two half sites found (corresponding to NNYNNYNNYNNY and RNNRNNRNNRNN, respectively) must be manually entered into the "Design a ZF" tool in order to obtain the two corresponding protein sequences.

Legend: The N- and C- termini of ZFPs are labeled, as are the 5' and 3' ends of each DNA strand. F1 refers to finger 1 of each ZFP, and F refers to the Fok I nuclease catalytic domain (example of a domain typically fused at the C-term of a ZFP). R refers to the catalytic domains of an unspecified protein fused at the N-term. The core sequence of 6 random bases is denoted by N and the 4-finger ZFPs are specified as they would need to be to search all 32 ANN and GNN triplets.

Citations If you are publishing results that include zinc finger proteins designed using this website, please reference ZF Tools using the following citation:

Mandell JG, Barbas CF 3rd. Zinc Finger Tools: custom DNA-binding domains for transcription factors and nucleases. Nucleic Acids Res. 2006 Jul 1;34 (Web Server issue):W516-23.

Also, please cite the appropriate papers for the triplets used:
GNN Segal DJ, Dreier B, Beerli RR, Barbas CF 3rd. Toward controlling gene expression at will: selection and design of zinc finger domains recognizing each of the 5'-GNN-3' DNA target sequences. Proc Natl Acad Sci U S A. 1999 Mar 16;96(6):2758-63.
GNN Dreier B, Segal DJ, Barbas CF 3rd. Insights into the molecular recognition of the 5'-GNN-3' family of DNA sequences by zinc finger domains. J Mol Biol. 2000 Nov 3;303(4):489-502.
ANN Dreier B, Beerli RR, Segal DJ, Flippin JD, Barbas CF 3rd. Development of zinc finger domains for recognition of the 5'-ANN-3' family of DNA sequences and their use in the construction of artificial transcription factors. J Biol Chem. 2001 Aug 3;276(31):29466-78.
CNN Dreier B, Fuller RP, Segal DJ, Lund C, Blancafort P, Huber A, Koksch B, Barbas CF 3rd. Development of zinc finger domains for recognition of the 5'-CNN-3' family DNA sequences and their use in the construction of artificial transcription factors. J Biol Chem. 2005 Aug 17.
TNN Blancafort P, Magnenat L, Barbas CF 3rd. Scanning the human genome with combinatorial transcription factor libraries. Nat Biotechnol. 2003 Mar;21(3):269-74.

For a listing of all our papers, search our laboratory publications here.

Please also see the following references of interest:

For the first reports of endogenous gene regulation with ZFPs and the use of effector domains as we have described:

Beerli RR, Segal DJ, Dreier B, Barbas CF 3rd. Toward controlling gene expression at will: specific regulation of the erbB-2/HER-2 promoter by using polydactyl zinc finger proteins constructed from modular building blocks. Proc Natl Acad Sci U S A. 1998 Dec 8;95(25):14628-33.

Beerli RR, Dreier B, Barbas CF 3rd. Positive and negative regulation of endogenous genes by designed transcription factors. Proc Natl Acad Sci U S A. 2000 Feb 15;97(4):1495-500.

For chemical regulation of zinc finger transcription factors:
Beerli RR, Schopfer U, Dreier B, Barbas CF 3rd. Chemically regulated zinc finger transcription factors. J Biol Chem. 2000 Oct 20;275(42):32617-27.

For the use of transcription factor libraries:
Lindhout BI, Pinas JE, Hooykaas PJ, van der Zaal BJ. Employing libraries of zinc finger artificial transcription factors to screen for homologous recombination mutants in Arabidopsis. Plant J. 2006 Nov;48(3):475-83.

Blancafort P, Chen EI, Gonzalez B, Bergquist S, Zijlstra A, Guthy D, Brachat A, Brakenhoff RH, Quigley JP, Erdmann D, Barbas CF 3rd. Genetic reprogramming of tumor cells by zinc finger transcription factors. Proc Natl Acad Sci U S A. 2005 Aug 16;102(33):11716-21.

Blancafort P, Magnenat L, Barbas CF 3rd. Scanning the human genome with combinatorial transcription factor libraries. Nat Biotechnol. 2003 Mar;21(3):269-74.

Lund CV, Blancafort P, Popkov M, Barbas CF 3rd. Promoter-targeted phage display selections with preassembled synthetic zinc finger libraries for endogenous gene regulation. J Mol Biol. 2004 Jul 9;340(3):599-613.

Magnenat L, Blancafort P, Barbas CF 3rd. In vivo selection of combinatorial libraries and designed affinity maturation of polydactyl zinc finger transcription factors for ICAM-1 provides new insights into gene regulation. J Mol Biol. 2004 Aug 13;341(3):635-49.

For reviews:
Beerli RR, Barbas CF 3rd. Engineering polydactyl zinc-finger transcription factors. Nat Biotechnol. 2002 Feb;20(2):135-41.

Blancafort P, Segal DJ, Barbas CF 3rd. Designing transcription factor architectures for drug discovery. Mol Pharmacol. 2004 Dec;66(6):1361-71.

Durai S, Mani M, Kandavelou K, Wu J, Porteus MH, Chandrasegaran S. Zinc finger nucleases: custom-designed molecular scissors for genome engineering of plant and mammalian cells. Nucleic Acids Res. 2005 Oct 26;33(18):5978-90.

For zinc finger nuclease applications:
Gene mutation in Caenorhabditis elegans: Morton J, Davis MW, Jorgensen EM, Carroll D. Induction and repair of zinc-finger nuclease-targeted double-strand breaks in Caenorhabditis elegans somatic cells. Proc Natl Acad Sci U S A. 2006 Oct 31;103(44):16370-5.

Gene mutation in Drosophila: Bibikova M, Golic M, Golic KG, Carroll D. Targeted chromosomal cleavage and mutagenesis in Drosophila using zinc-finger nucleases. Genetics. 2002 Jul;161(3):1169-75.

Gene mutation in Arabidopsis: Lloyd A, Plaisier CL, Carroll D, Drews GN. Targeted mutagenesis using zinc-finger nucleases in Arabidopsis. Proc Natl Acad Sci U S A. 2005 Feb 8;102(6):2232-7.

High efficiency targeted gene repair in human cells: Urnov FD et al. Highly efficient endogenous human gene correction using designed zinc-finger nucleases. Nature. 2005 Jun 2;435(7042):646-51.

About this site ZF Tools was created by Jeff Mandell for the Barbas Laboratory at TSRI. The purpose of the site is to assist researchers who want to design zinc finger proteins (ZFPs). Although the rules describing how ZFPs recognizing a specific DNA sequence can be constructed are well described, their application is not always straightforward. ZF Tools can save researchers the substantial time and effort required to design ZFPs. ZF Tools will also identify DNA sites that can be targeted by ZFPs, thus making it possible to quickly scan any DNA sequence for potential target sites.

Disclaimer:
While every effort has been made to ensure the accuracy of the information reported on this site, we make no guarantees
and strongly suggest that you double check all sequences and information obtained here before using them.